SAMtool bitwise flag meaning explained: how to understand samflags without pains

Posted by Pico on August 25, 2010
Posted in: Genome, Science. 18 Comments

If you got samflags and want to know their meaning quickly then you can check their meaning interactively following this link. You type in a flag and will get the answer at Piacrd official site.

You can also look up the meaning of samflags in a pdf file sam_output in pdf. Or it looks like this:

(Provided by WTSI Pathogen Unit). If you do not see the flag you are after, then you can check the picard page or go further below to get actual individual flag components. Or you can just forget about it as an error and check aligners.

Please notice positional order of the paired reads “matters” if they are pointing inward or outward.

That is, if you see

A)

1.==>  2.==>

1.<==   2.<==

then the flags are same, since

B)

2.==>  1.==>

2.<==   1.<==

are exactly same to A).

But,

1.==>  2.<==

is not same as

2.<==  1.==>

or vice versa.

This can indicate tandem or episomal duplications or errors. If reads are overlapping, then you see this quite often.  (Even experts may not know this. It took me more than 30 minutes convince people.)  If you are in doubt, please check all read flags carefully. You may not see them since they can be very rare, which does not mean they do not exist.

It is not easy to identify structural variation (SV) solely based on insert sizes. People unaware of this difficulty think they can just find SVs from their insert sizes: Sorry, but it is not that simple. I was able to find only extremely tandemly repeated gene arrays with this method. Especially it is almost impossible to do this for a draft reference containing  many errors.

Here is the flags you should expect after mapping. They are insert size. Note: the orientation of some reads is not defined, and I do not know why. To analyse the flags properly, you may have to order bam files by their name, since you need to know the mapping status of mates. For instance, you need to know both sam flags and positional arrangement of reads. Insert size can help to throw away badly mapped reads but identifying valid SVs is really tough. Or the parasites I  am working on may not have very many SVs.

Please check the 1000G paper to find SV detection.  The paper A map of human genome variation from population-scale sequencing is available from the Nature web site and is distributed under the terms of the Creative Commons Attribution-Non-Commercial-Share Alike licence to ensure wide distribution.
There are many errors in this figure. The direction is not defined in 65 and 129. I need to fix this.

Structural Variant based on Apparent Insert Size:
Small insertion => Decrease
Small deletion => Increase
Large deletion => Increase
Intrachromosomal translocation => Increase
Interchromosomal translocation => Change mate chromosome
Large insertion                                => Increase or lack of mapped mate

From: Finding Structural Variants in Short Read, Paired-end Sequence Data with R and Bioconductor by Sean Davis

General Information

http://samtools.sourceforge.net/

Other Lang-bindings

Or more generally they are
0x0001 1 the read is paired in sequencing, no matter whether it is mapped in a pair
0x0002 2 the read is mapped in a proper pair (depends on the protocol, normally inferred during alignment)
0x0004 4 the query sequence itself is unmapped
0x0008 8 the mate is unmapped
0x0010 16 strand of the query (0 for forward; 1 for reverse strand)
0x0020 32 strand of the mate
0x0040 64 the read is the first read in a pair
0x0080 128 the read is the second read in a pair
0x0100 256 the alignment is not primary (a read having split hits may have multiple primary alignment records)

========== PrintSamFlag.pl : Usage perl PrintSamFlag.pl input.bam > output

# This program will print out a flag status like this

64706  65 ‘1”64’
61396  69 ‘1”4”64’
66631  73 ‘1”8”64’
130783  77 ‘1”4”8”64’
151001  81 ‘1”16”64’
4225910  83 ‘1”2”16”64’
63678  89 ‘1”8”16”64’
151042  97 ‘1”32”64’
4188825  99 ‘1”2”32”64’
61159  101 ‘1”4”32”64’
63276  113 ‘1”16”32”64’
64707  129 ‘1”128’
66631  133 ‘1”4”128’
61396  137 ‘1”8”128’
130783  141 ‘1”4”8”128’
151042  145 ‘1”16”128’
4200609  147 ‘1”2”16”128’
61159  153 ‘1”8”16”128’
151001  161 ‘1”32”128’
4175327  163 ‘1”2”32”128’
63678  165 ‘1”4”32”128’
63276  177 ‘1”16”32”128’
=======Please copy and paste the following lines and check they are pasted correctly.===========

#!/usr/bin/perl
use strict;
my ($in)=@ARGV;
if ($in=~"\.bam"){
open F1," samtools view $in |" or die;
}
if ($in=~"\.sam"){
open F1,$in  or die;
}

my (%flag,%INS,$n1,$n2,@x,$InsS,$P);
while (my $s=<F1>)
{
@x=split '\s+',$s;
++$flag{$x[1]};
++$INS{$x[1]};
#paired
if (SAMflag($x[1])=~"\'2\'"){
#print   SAMflag($x[1]) ,"\n";
$InsS+=$x[8];
++$P;
}
}
close F1;

for my $k (sort {$a<=>$b}keys %flag){
print "$flag{$k}  $k ",SAMflag($k),"\n";
}
my %TABLE= qw(  0   '0'
1 '1'
2 '2'
3 '1''2'
4 '4'
5 '1''4'
6 '2''4'
7 '1''2''4'
8 '8'
9 '1''8'
10 '2''8'
11 '1''2''8'
12 '4''8'
13 '1''4''8'
14 '2''4''8'
15 '1''2''4''8'
16 '16'
17 '1''16'
18 '2''16'
19 '1''2''16'
20 '4''16'
21 '1''4''16'
22 '2''4''16'
23 '1''2''4''16'
24 '8''16'
25 '1''8''16'
26 '2''8''16'
27 '1''2''8''16'
28 '4''8''16'
29 '1''4''8''16'
30 '2''4''8''16'
31 '1''2''4''8''16'
32 '32'
33 '1''32'
34 '2''32'
35 '1''2''32'
36 '4''32'
37 '1''4''32'
38 '2''4''32'
39 '1''2''4''32'
40 '8''32'
41 '1''8''32'
42 '2''8''32'
43 '1''2''8''32'
44 '4''8''32'
45 '1''4''8''32'
46 '2''4''8''32'
47 '1''2''4''8''32'
48 '16''32'
49 '1''16''32'
50 '2''16''32'
51 '1''2''16''32'
52 '4''16''32'
53 '1''4''16''32'
54 '2''4''16''32'
55 '1''2''4''16''32'
56 '8''16''32'
57 '1''8''16''32'
58 '2''8''16''32'
59 '1''2''8''16''32'
60 '4''8''16''32'
61 '1''4''8''16''32'
62 '2''4''8''16''32'
63 '1''2''4''8''16''32'
64 '64'
65 '1''64'
66 '2''64'
67 '1''2''64'
68 '4''64'
69 '1''4''64'
70 '2''4''64'
71 '1''2''4''64'
72 '8''64'
73 '1''8''64'
74 '2''8''64'
75 '1''2''8''64'
76 '4''8''64'
77 '1''4''8''64'
78 '2''4''8''64'
79 '1''2''4''8''64'
80 '16''64'
81 '1''16''64'
82 '2''16''64'
83 '1''2''16''64'
84 '4''16''64'
85 '1''4''16''64'
86 '2''4''16''64'
87 '1''2''4''16''64'
88 '8''16''64'
89 '1''8''16''64'
90 '2''8''16''64'
91 '1''2''8''16''64'
92 '4''8''16''64'
93 '1''4''8''16''64'
94 '2''4''8''16''64'
95 '1''2''4''8''16''64'
96 '32''64'
97 '1''32''64'
98 '2''32''64'
99 '1''2''32''64'
100 '4''32''64'
101 '1''4''32''64'
102 '2''4''32''64'
103 '1''2''4''32''64'
104 '8''32''64'
105 '1''8''32''64'
106 '2''8''32''64'
107 '1''2''8''32''64'
108 '4''8''32''64'
109 '1''4''8''32''64'
110 '2''4''8''32''64'
111 '1''2''4''8''32''64'
112 '16''32''64'
113 '1''16''32''64'
114 '2''16''32''64'
115 '1''2''16''32''64'
116 '4''16''32''64'
117 '1''4''16''32''64'
118 '2''4''16''32''64'
119 '1''2''4''16''32''64'
120 '8''16''32''64'
121 '1''8''16''32''64'
122 '2''8''16''32''64'
123 '1''2''8''16''32''64'
124 '4''8''16''32''64'
125 '1''4''8''16''32''64'
126 '2''4''8''16''32''64'
127 '1''2''4''8''16''32''64'
128 '128'
129 '1''128'
130 '2''128'
131 '1''2''128'
132 '4''128'
133 '1''4''128'
134 '2''4''128'
135 '1''2''4''128'
136 '8''128'
137 '1''8''128'
138 '2''8''128'
139 '1''2''8''128'
140 '4''8''128'
141 '1''4''8''128'
142 '2''4''8''128'
143 '1''2''4''8''128'
144 '16''128'
145 '1''16''128'
146 '2''16''128'
147 '1''2''16''128'
148 '4''16''128'
149 '1''4''16''128'
150 '2''4''16''128'
151 '1''2''4''16''128'
152 '8''16''128'
153 '1''8''16''128'
154 '2''8''16''128'
155 '1''2''8''16''128'
156 '4''8''16''128'
157 '1''4''8''16''128'
158 '2''4''8''16''128'
159 '1''2''4''8''16''128'
160 '32''128'
161 '1''32''128'
162 '2''32''128'
163 '1''2''32''128'
164 '4''32''128'
165 '1''4''32''128'
166 '2''4''32''128'
167 '1''2''4''32''128'
168 '8''32''128'
169 '1''8''32''128'
170 '2''8''32''128'
171 '1''2''8''32''128'
172 '4''8''32''128'
173 '1''4''8''32''128'
174 '2''4''8''32''128'
175 '1''2''4''8''32''128'
176 '16''32''128'
177 '1''16''32''128'
178 '2''16''32''128'
179 '1''2''16''32''128'
180 '4''16''32''128'
181 '1''4''16''32''128'
182 '2''4''16''32''128'
183 '1''2''4''16''32''128'
184 '8''16''32''128'
185 '1''8''16''32''128'
186 '2''8''16''32''128'
187 '1''2''8''16''32''128'
188 '4''8''16''32''128'
189 '1''4''8''16''32''128'
190 '2''4''8''16''32''128'
191 '1''2''4''8''16''32''128'
192 '64''128'
193 '1''64''128'
194 '2''64''128'
195 '1''2''64''128'
196 '4''64''128'
197 '1''4''64''128'
198 '2''4''64''128'
199 '1''2''4''64''128'
200 '8''64''128'
201 '1''8''64''128'
202 '2''8''64''128'
203 '1''2''8''64''128'
204 '4''8''64''128'
205 '1''4''8''64''128'
206 '2''4''8''64''128'
207 '1''2''4''8''64''128'
208 '16''64''128'
209 '1''16''64''128'
210 '2''16''64''128'
211 '1''2''16''64''128'
212 '4''16''64''128'
213 '1''4''16''64''128'
214 '2''4''16''64''128'
215 '1''2''4''16''64''128'
216 '8''16''64''128'
217 '1''8''16''64''128'
218 '2''8''16''64''128'
219 '1''2''8''16''64''128'
220 '4''8''16''64''128'
221 '1''4''8''16''64''128'
222 '2''4''8''16''64''128'
223 '1''2''4''8''16''64''128'
224 '32''64''128'
225 '1''32''64''128'
226 '2''32''64''128'
227 '1''2''32''64''128'
228 '4''32''64''128'
229 '1''4''32''64''128'
230 '2''4''32''64''128'
231 '1''2''4''32''64''128'
232 '8''32''64''128'
233 '1''8''32''64''128'
234 '2''8''32''64''128'
235 '1''2''8''32''64''128'
236 '4''8''32''64''128'
237 '1''4''8''32''64''128'
238 '2''4''8''32''64''128'
239 '1''2''4''8''32''64''128'
240 '16''32''64''128'
241 '1''16''32''64''128'
242 '2''16''32''64''128'
243 '1''2''16''32''64''128'
244 '4''16''32''64''128'
245 '1''4''16''32''64''128'
246 '2''4''16''32''64''128'
247 '1''2''4''16''32''64''128'
248 '8''16''32''64''128'
249 '1''8''16''32''64''128'
250 '2''8''16''32''64''128'
251 '1''2''8''16''32''64''128'
252 '4''8''16''32''64''128'
253 '1''4''8''16''32''64''128'
254 '2''4''8''16''32''64''128'
255 '1''2''4''8''16''32''64''128');

sub SAMflag{
my $i=shift;
return  $TABLE{$i};
}

#======= END ====================

SAMtool bitwise flag: A table of flags with combination of integers in perl format. There is a better way to do this but it is useful, for some.:)

 use strict;
 my %TABLE=
qw(0   0
 1   1
 2   2
 3   1+2
 4   0+4
 5   1+4
 6   0+2+4
 7   1+2+4
 8   0+8
 9   1+8
 10   0+2+8
 11   1+2+8
 12   0+4+8
 13   1+4+8
 14   0+2+4+8
 15   1+2+4+8
 16   0+16
 17   1+16
 18   0+2+16
 19   1+2+16
 20   0+4+16
 21   1+4+16
 22   0+2+4+16
 23   1+2+4+16
 24   0+8+16
 25   1+8+16
 26   0+2+8+16
 27   1+2+8+16
 28   0+4+8+16
 29   1+4+8+16
 30   0+2+4+8+16
 31   1+2+4+8+16
 32   0+32
 33   1+32
 34   0+2+32
 35   1+2+32
 36   0+4+32
 37   1+4+32
 38   0+2+4+32
 39   1+2+4+32
 40   0+8+32
 41   1+8+32
 42   0+2+8+32
 43   1+2+8+32
 44   0+4+8+32
 45   1+4+8+32
 46   0+2+4+8+32
 47   1+2+4+8+32
 48   0+16+32
 49   1+16+32
 50   0+2+16+32
 51   1+2+16+32
 52   0+4+16+32
 53   1+4+16+32
 54   0+2+4+16+32
 55   1+2+4+16+32
 56   0+8+16+32
 57   1+8+16+32
 58   0+2+8+16+32
 59   1+2+8+16+32
 60   0+4+8+16+32
 61   1+4+8+16+32
 62   0+2+4+8+16+32
 63   1+2+4+8+16+32
 64   0+64
 65   1+64
 66   0+2+64
 67   1+2+64
 68   0+4+64
 69   1+4+64
 70   0+2+4+64
 71   1+2+4+64
 72   0+8+64
 73   1+8+64
 74   0+2+8+64
 75   1+2+8+64
 76   0+4+8+64
 77   1+4+8+64
 78   0+2+4+8+64
 79   1+2+4+8+64
 80   0+16+64
 81   1+16+64
 82   0+2+16+64
 83   1+2+16+64
 84   0+4+16+64
 85   1+4+16+64
 86   0+2+4+16+64
 87   1+2+4+16+64
 88   0+8+16+64
 89   1+8+16+64
 90   0+2+8+16+64
 91   1+2+8+16+64
 92   0+4+8+16+64
 93   1+4+8+16+64
 94   0+2+4+8+16+64
 95   1+2+4+8+16+64
 96   0+32+64
 97   1+32+64
 98   0+2+32+64
 99   1+2+32+64
 100   0+4+32+64
 101   1+4+32+64
 102   0+2+4+32+64
 103   1+2+4+32+64
 104   0+8+32+64
 105   1+8+32+64
 106   0+2+8+32+64
 107   1+2+8+32+64
 108   0+4+8+32+64
 109   1+4+8+32+64
 110   0+2+4+8+32+64
 111   1+2+4+8+32+64
 112   0+16+32+64
 113   1+16+32+64
 114   0+2+16+32+64
 115   1+2+16+32+64
 116   0+4+16+32+64
 117   1+4+16+32+64
 118   0+2+4+16+32+64
 119   1+2+4+16+32+64
 120   0+8+16+32+64
 121   1+8+16+32+64
 122   0+2+8+16+32+64
 123   1+2+8+16+32+64
 124   0+4+8+16+32+64
 125   1+4+8+16+32+64
 126   0+2+4+8+16+32+64
 127   1+2+4+8+16+32+64
 128   0+128
 129   1+128
 130   0+2+128
 131   1+2+128
 132   0+4+128
 133   1+4+128
 134   0+2+4+128
 135   1+2+4+128
 136   0+8+128
 137   1+8+128
 138   0+2+8+128
 139   1+2+8+128
 140   0+4+8+128
 141   1+4+8+128
 142   0+2+4+8+128
 143   1+2+4+8+128
 144   0+16+128
 145   1+16+128
 146   0+2+16+128
 147   1+2+16+128
 148   0+4+16+128
 149   1+4+16+128
 150   0+2+4+16+128
 151   1+2+4+16+128
 152   0+8+16+128
 153   1+8+16+128
 154   0+2+8+16+128
 155   1+2+8+16+128
 156   0+4+8+16+128
 157   1+4+8+16+128
 158   0+2+4+8+16+128
 159   1+2+4+8+16+128
 160   0+32+128
 161   1+32+128
 162   0+2+32+128
 163   1+2+32+128
 164   0+4+32+128
 165   1+4+32+128
 166   0+2+4+32+128
 167   1+2+4+32+128
 168   0+8+32+128
 169   1+8+32+128
 170   0+2+8+32+128
 171   1+2+8+32+128
 172   0+4+8+32+128
 173   1+4+8+32+128
 174   0+2+4+8+32+128
 175   1+2+4+8+32+128
 176   0+16+32+128
 177   1+16+32+128
 178   0+2+16+32+128
 179   1+2+16+32+128
 180   0+4+16+32+128
 181   1+4+16+32+128
 182   0+2+4+16+32+128
 183   1+2+4+16+32+128
 184   0+8+16+32+128
 185   1+8+16+32+128
 186   0+2+8+16+32+128
 187   1+2+8+16+32+128
 188   0+4+8+16+32+128
 189   1+4+8+16+32+128
 190   0+2+4+8+16+32+128
 191   1+2+4+8+16+32+128
 192   0+64+128
 193   1+64+128
 194   0+2+64+128
 195   1+2+64+128
 196   0+4+64+128
 197   1+4+64+128
 198   0+2+4+64+128
 199   1+2+4+64+128
 200   0+8+64+128
 201   1+8+64+128
 202   0+2+8+64+128
 203   1+2+8+64+128
 204   0+4+8+64+128
 205   1+4+8+64+128
 206   0+2+4+8+64+128
 207   1+2+4+8+64+128
 208   0+16+64+128
 209   1+16+64+128
 210   0+2+16+64+128
 211   1+2+16+64+128
 212   0+4+16+64+128
 213   1+4+16+64+128
 214   0+2+4+16+64+128
 215   1+2+4+16+64+128
 216   0+8+16+64+128
 217   1+8+16+64+128
 218   0+2+8+16+64+128
 219   1+2+8+16+64+128
 220   0+4+8+16+64+128
 221   1+4+8+16+64+128
 222   0+2+4+8+16+64+128
 223   1+2+4+8+16+64+128
 224   0+32+64+128
 225   1+32+64+128
 226   0+2+32+64+128
 227   1+2+32+64+128
 228   0+4+32+64+128
 229   1+4+32+64+128
 230   0+2+4+32+64+128
 231   1+2+4+32+64+128
 232   0+8+32+64+128
 233   1+8+32+64+128
 234   0+2+8+32+64+128
 235   1+2+8+32+64+128
 236   0+4+8+32+64+128
 237   1+4+8+32+64+128
 238   0+2+4+8+32+64+128
 239   1+2+4+8+32+64+128
 240   0+16+32+64+128
 241   1+16+32+64+128
 242   0+2+16+32+64+128
 243   1+2+16+32+64+128
 244   0+4+16+32+64+128
 245   1+4+16+32+64+128
 246   0+2+4+16+32+64+128
 247   1+2+4+16+32+64+128
 248   0+8+16+32+64+128
 249   1+8+16+32+64+128
 250   0+2+8+16+32+64+128
 251   1+2+8+16+32+64+128
 252   0+4+8+16+32+64+128
 253   1+4+8+16+32+64+128
 254   0+2+4+8+16+32+64+128
 255   1+2+4+8+16+32+64+128);

18 comments on “SAMtool bitwise flag meaning explained: how to understand samflags without pains”

  1. Flag for properly paired reads.

    samtools view -f 2
    will give you properly mapped pair.

    Usage: samtools view [options] | [region1 […]]

    Options: -b output BAM
    -h print header for the SAM output
    -H print header only (no alignments)
    -S input is SAM
    -u uncompressed BAM output (force -b)
    -x output FLAG in HEX (samtools-C specific)
    -X output FLAG in string (samtools-C specific)
    -t FILE list of reference names and lengths (force -S) [null]
    -T FILE reference sequence file (force -S) [null]
    -o FILE output file name [stdout]
    -f INT required flag, 0 for unset [0]
    -F INT filtering flag, 0 for unset [0]
    -q INT minimum mapping quality [0]
    -l STR only output reads in library STR [null]
    -r STR only output reads in read group STR [null]
    -? longer help

  4. Hello, need help for samtools or other methods.
    You know that the Sequence Alignment/Map (SAM) format is a generic alignment format for storing read alignments against reference sequences. If a patient’s BAM file is given, how can you extract the sequence from the storing read alignments(not from the reference) within a region? For example, chr22: 1000000-1234000.
    Somebody in an online forum totally misunderstood my question and I haven’t get a solution. So I ask for help whereever it is possible. The guy used “samtools faidx ref.fasta”, but this result from the reference instead of the patient’s read.
    Thanks for any hint or a piece of code.

  5. Thanks for this post. It was definitely helpful. I was wondering if you could elaborate a little more on the:

    “the alignment is not primary (a read having split hits may have multiple primary alignment records)”

    Does this mean that if a read has multiple alignments, then one of the alignments is considered the primary alignment? How does this primary alignment get assigned? Is it based on the best of all the alignments?

    Thanks,

  6. ardmore: If a patient’s BAM file is given, how can you extract the sequence from the storing read alignments(not from the reference) within a region? For example, chr22: 1000000-1234000.

    Sorry I did not check this for a while. It is indeed tricky: you need reverse complement reverse reads: 1 st mates.
    Here is bam2 fastq for a given region.

    perl Bam2fastqR.pl my.bam chr_name start end
    perl Bam2fastqR.pl my.bam chr01 1000 3000
    makes
    my.2.fastq

    ###Bam2fastqR.pl (For reverse reads )=======================================
    use strict;
    use Cwd;
    my ($in,$chr,$sta,$end)=@ARGV;
    open F1,”samtools view -f 64 $in ‘$chr\:$sta\-$end’ |” or die;
    my (@x,@z,$pr1,$pr2,$rb,$rs);
    my (@y)=split ‘\.’,$in;
    open R1, “>$y[0].1.fastq”;
    while (my $s=){
    (@x)=split ‘\s+’,$s;
    $rs=revdnacomp($x[9]);
    $rb=reverse($x[10]);# you need to reverse complement
    print R1 “\@$x[0]/1\n$rs\n+\n$rb\n”;
    }
    sub revdnacomp {
    my $dna = shift;
    my $revcomp = reverse($dna);
    $revcomp =~ tr/ACGTacgt/TGCAtgca/;
    return $revcomp;
    }
    #### END =======================================

    ###Bam2fastqF.pl (For forward reads )
    use strict;
    use Cwd;
    my ($in,$chr,$sta,$end)=@ARGV;
    open F1,”samtools view -f 128 $in ‘$chr\:$sta\-$end’ |” or die;
    my (@x,@z,$pr1,$pr2);
    my (@y)=split ‘\.’,$in;
    open R1, “>$y[0].2.fastq”;
    while (my $s=){
    (@x)=split ‘\s+’,$s;
    print R1 “\@$x[0]/2\n$x[9]\n+\n$x[10]\n”;
    }
    ================================================

    You need to run for both scripts. If they do not work, please let me know.

  7. “the alignment is not primary (a read having split hits may have multiple primary alignment records)”

    Does this mean that if a read has multiple alignments, then one of the alignments is considered the primary alignment? How does this primary alignment get assigned? Is it based on the best of all the alignments?
    ============
    I just copied it from the samtools manual. And the updated one tells us that
    “Bit 0x100 marks the alignment not to be used in certain analyses when the tools in use are
    aware of this bit.” So basically we should not use this one, unless an aligner specifically say we should use this flag. I talked with Heng before and he said this flag was to eliminate bad reads. (or something like that.)

  9. I borrowed the code from http://edwards.sdsu.edu/labsite/index.php/robert/289-how-to-convert-fastq-to-fasta
    But I got something in my fasta file like this, is it right?
    ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
    f[“c`_]d]aWi]c]dbgfi[aZ_d_n_nr[`jlvnmdimUbmb]mfUkkjg^faZ[ih
    ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~{~~~q~wq[\SVT\]]X`_a_c^XZZYT
    `zdsobkpRNRqx}l~`yoyvwo\c~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
    ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
    ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
    ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
    zxtuu~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
    ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~zsoml\R

  10. I think you are getting something like this. The first part is base and the second part is its quality.

    @Ld01_v01s1
    CTAACCCTAACCCTAACCCTAACCCTAACCAGYACACCAGTACACCGTCACGCCCCCGTC
    CTGTTGGAGAGGGTGTCGCKGTGCAAGGAATCAGTCGAGAGAAAAACCCTAACCCGTACC
    GGTACCGAGTTATCGTTTTTATTAGGTTACTAACCTCTGGCACGCTTGTCGCTGCTCTTC
    AGAACGAAACGCACAATGCTCTTCGATAAACGTGCTGAAATAGAAAAAAAAAACGAAAGA
    TCTCGGCTACGTTTGCTGCCGTTGGCCTCACCTCGTCATGGCGCGTCGGTCCACCAAAGA
    +
    ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~d~~~~~~~~~~~~~~~~~~~~~~~~~~~
    ~~~~~~~~~~~~~~~~~~~O~~~~~~~~~~~~~~~:~~~~~~~~~~~~~~~~~~~~~~~~
    ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
    ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
    ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
    ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
    ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~

  12. A:
    samtools view -f 16
    0 + 16 => 16

    Usage: samtools view [options] | [region1 […]]

    Options: -b output BAM
    -h print header for the SAM output
    -H print header only (no alignments)
    -S input is SAM
    -u uncompressed BAM output (force -b)
    -1 fast compression (force -b)
    -x output FLAG in HEX (samtools-C specific)
    -X output FLAG in string (samtools-C specific)
    -c print only the count of matching records
    -L FILE output alignments overlapping the input BED FILE [null]
    -t FILE list of reference names and lengths (force -S) [null]
    -T FILE reference sequence file (force -S) [null]
    -o FILE output file name [stdout]
    -R FILE list of read groups to be outputted [null]
    -f INT required flag, 0 for unset [0]
    -F INT filtering flag, 0 for unset [0]
    -q INT minimum mapping quality [0]
    -l STR only output reads in library STR [null]
    -r STR only output reads in read group STR [null]
    -s FLOAT fraction of templates to subsample; integer part as seed [-1]
    -? longer help

  13. how would I select alignments with flag 0 OR 16 using samtools?
    samtools view -f 16
    samtools view -f 0
    samtools view -f 17
    You needs pick 3 cases, I guess …

  14. Hi! Great post! 🙂

    Do you have any idea how to collect the uniquely mapped reads whose 5′ ends falls within a target exon? I’ve filtered for 99, 147, 86 and 163 flags but saddly I don’t have any idea how to get it…

    Can someone propose an approach? Thank you in advance!

  15. >Do you have any idea how to collect the uniquely mapped reads whose 5′ ends falls within a target exon? I’ve filtered for 99, 147, 86 and 163 flags but saddly I don’t have any idea how to get it…

    It seems manipulating flags is not enough to get the info … Let me see.

  17. Maybe filtering from a sam file? If you discard the reads according to the fourth column… should work!

Leave a comment